Sequence ID | >WENV170648836 |
Genome ID | JRHI01002770 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 8207 |
End posion on genome | 8291 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acgtatgtaa |
tRNA gene sequence |
GCCGAAGTGGCGGAACTGGCAGACGCACGCGACTCAAAATCGCGCGAGGTAACCCCTCGT |
Downstream region at tRNA end position |
tactttcggc |
Secondary structure (Cloverleaf model) | >WENV170648836 Leu CAA a Atgt tactttcggc G - C C - G C - G G - C A - T A C G - C T C T C A C C C A C A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C C A G A CGAGGTAACCCCTCGT C - G G - C C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |