Sequence ID | >WENV170648840 |
Genome ID | JRHI01002801 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 5079 |
End posion on genome | 5163 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atggcggcaa |
tRNA gene sequence |
GCGGACGTGGCGAAACTGGTAGACGCAAGGGACTTAAAATCCCTCGACTTCGGTCATACG |
Downstream region at tRNA end position |
aagcttatgg |
Secondary structure (Cloverleaf model) | >WENV170648840 Leu TAA a ACCA aagcttatgg G - C C - G G - C G - C A - T C - G G - C T C T T G C C C A C A A G | | | | | G T A G C G A C G G G C G | | | T T G A C G C T A G A CGACTTCGGTCAT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |