Sequence ID | >WENV170648871 |
Genome ID | JRHI01003151 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 9980 |
End posion on genome | 9893 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ctctcccccc |
tRNA gene sequence |
GGAGGGATGCGAGAGCGGCCGAATCGGATGGTCTCGAAAACCATTGTGCCTTCGGGCACC |
Downstream region at tRNA end position |
ccgtgtcagg |
Secondary structure (Cloverleaf model) | >WENV170648871 Ser CGA c GCCA ccgtgtcagg G - C G - C A - T G - C G - C G - C A - T T A T C A C C C A C G A G | | | | | A G G A G C G T G G G C G | | | T T C A T C G C G A G TGTGCCTTCGGGCACC A - T T - A G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |