Sequence ID | >WENV170648883 |
Genome ID | JRHI01003293 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2293 |
End posion on genome | 2200 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttccgacgc |
tRNA gene sequence |
GGTGAGGTGGCCGAGAGGCTGAAGGCGGCGGTTTGCTAAACCGTTATACGGCCTAAAAGC |
Downstream region at tRNA end position |
gttttccccc |
Secondary structure (Cloverleaf model) | >WENV170648883 Ser GCT c GCCA gttttccccc G - C G - C T - A G - C A - T G - C G - C T A T G T C C C A A G A G | | | | | G G G C C G C A G G G C G | | | T T C A G G C T G A G TATACGGCCTAAAAGCTGTATC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |