Sequence ID | >WENV170648888 |
Genome ID | JRHI01003324 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6227 |
End posion on genome | 6311 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aacccagcct |
tRNA gene sequence |
GCGCGGATGGCGGAACCGGTAGACGCGCGGGACTTAGGATCCCGTGGGGCAACCCATCCG |
Downstream region at tRNA end position |
cggccgcatc |
Secondary structure (Cloverleaf model) | >WENV170648888 Leu TAG t ACCA cggccgcatc G - C C - G G - C C - G G - C G - C A - T T G T G G C T C A C A A G | | | | | G C G G C G C C G A G C G | | | T T G A C G C T A G G TGGGGCAACCCAT C - G G - C G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |