Sequence ID | >WENV170648905 |
Genome ID | JRHI01003598 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 7622 |
End posion on genome | 7537 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcatttcgac |
tRNA gene sequence |
GGGGGTGTGGCGGAACGGTAGACGCAGTCGCCTCAAAAGCGACCGAGTGAATGCTCGTGT |
Downstream region at tRNA end position |
ggcagcgatg |
Secondary structure (Cloverleaf model) | >WENV170648905 Leu CAA c ACCA ggcagcgatg G - C G - C G - C G - C G - C T T G - C T A T C A C C C A C A A G | | | | | A G G G C G G T G G G C G | | | T T T A C G C A G A CGAGTGAATGCTCGT G - C T - A C - G G - C C - G C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |