Sequence ID | >WENV170648916 |
Genome ID | JRHI01003726 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 7389 |
End posion on genome | 7300 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgcggaccgc |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAAAGTGTGTATGCGGGAAACCGTA |
Downstream region at tRNA end position |
aatcgtctgt |
Secondary structure (Cloverleaf model) | >WENV170648916 Ser GGA c GCCA aatcgtctgt G - C G - C A - T G - C G - C G - C G + T T A T C G C C C A T G A G | | | | | G G G C C G G C G G G C G | | | T T T A G G C T G A G TATGCGGGAAACCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |