Sequence ID | >WENV170648939 |
Genome ID | JRHI01003967 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6817 |
End posion on genome | 6727 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccggaccgcg |
tRNA gene sequence |
GGAGAGGTGCTGGAGCGGTCGAACAGGCACGCCTGGAAAGCGTGTAGACGCTAAACCCGT |
Downstream region at tRNA end position |
tggatttcac |
Secondary structure (Cloverleaf model) | >WENV170648939 Ser GGA g GCCA tggatttcac G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | G G G G T C G A G G G C G | | | T T T A C A G C G A G TAGACGCTAAACCCGTCTC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |