Sequence ID | >WENV170648951 |
Genome ID | JRHI01004072 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 5030 |
End posion on genome | 4946 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgagcatcaa |
tRNA gene sequence |
GGTCCGGTAGCCGAATTGGCATAGGCACCACACTCAGAATGTGGGCCCGAAAGGGCACCT |
Downstream region at tRNA end position |
tctctcgcgg |
Secondary structure (Cloverleaf model) | >WENV170648951 Leu CAG a Atcc tctctcgcgg G - C G - C T - A C - G C - G G - C G - C T G T C A C C C A T A A A | | | | | A T G C C G G T G G G C G | | | T T G A G G C C A T A GCCCGAAAGGGCACCT C - G C - G A - T C - G A - T C A T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |