Sequence ID | >WENV170648952 |
Genome ID | JRHI01004072 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 4829 |
End posion on genome | 4739 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaacgactcT |
tRNA gene sequence |
GCACGGGTGGCGAAATTGGCAGACGCGCTAGGTTGAGGGCCTAGTGTTCCGAAAGGACAC |
Downstream region at tRNA end position |
ttcgcgagtg |
Secondary structure (Cloverleaf model) | >WENV170648952 Leu GAG T ATCA ttcgcgagtg G - C C - G A - T C - G G - C G - C G + T T G T C G C C C A T A A G | | | | | A T A G C G G C G G G C G | | | T T G A C G C C A G G TGTTCCGAAAGGACACCT C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |