Sequence ID | >WENV170648973 |
Genome ID | JRHI01004328 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1659 |
End posion on genome | 1572 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aactattcct |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTGAAGGCACCGGTCTCGAAAACCGGCATACCGGCAACGGTA |
Downstream region at tRNA end position |
gcgaacgtgc |
Secondary structure (Cloverleaf model) | >WENV170648973 Ser CGA t GCtc gcgaacgtgc G - C G - C A - T C - G A - T G - C G - C T A T C A C T C A T G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C T G A A CATACCGGCAACGGTATC C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |