Sequence ID | >WENV170648984 |
Genome ID | JRHI01004587 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 4735 |
End posion on genome | 4650 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggtctcgtgT |
tRNA gene sequence |
GGGTAGGTGGCCGAGTGGTTAAAGGCGACAGACTGTAAATCTGTTCCGCATCGCGGTACG |
Downstream region at tRNA end position |
agcgcgcggg |
Secondary structure (Cloverleaf model) | >WENV170648984 Tyr GTA T AAtg agcgcgcggg G - C G - C G - C T + G A - T G - C G - C T A T C T C C C A T G A G | + | | | G G G C C G G G G G G C G | | | T T T A G G C T A A G TCCGCATCGCGGTAC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |