Sequence ID | >WENV170648991 |
Genome ID | JRHI01004647 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1051 |
End posion on genome | 1136 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
accctcgtac |
tRNA gene sequence |
GCGGAAGTGGCGGAACGGCAGACGCACCAGCTTGAGGGGCTGGCGATCGCAAGATCGTGG |
Downstream region at tRNA end position |
tcgttatggt |
Secondary structure (Cloverleaf model) | >WENV170648991 Leu GAG c ACCA tcgttatggt G - C C - G G - C G - C A - T A - T G - C T A T T C T C C A C A A G + | | | | G G G G C G G G A G G C G | | | T T C A C G C A G A CGATCGCAAGATCGT C - G C - G A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |