Sequence ID | >WENV170648995 |
Genome ID | JRHI01004858 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2965 |
End posion on genome | 2872 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccttccgcac |
tRNA gene sequence |
GGGGAGGTGGCTGAGCTTGGTCGAAAGCGCCCGCCTGCTAAGTGGGTAGGGGGTTAACTC |
Downstream region at tRNA end position |
gtttcgaagt |
Secondary structure (Cloverleaf model) | >WENV170648995 Ser GCT c GCCA gtttcgaagt G - C G - C G - C G + T A - T G - C G - C T A T C T C C C A T C G A G | | | | | A T G T C G G A G G G C G | | | T T G A A G C T C G A G TAGGGGGTTAACTCTCCCTC C - G C - G C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |