Sequence ID | >WENV170649031 |
Genome ID | JRHI01005196 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 222 |
End posion on genome | 311 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggcctgccgc |
tRNA gene sequence |
GGAGGAGTGCCGGAGTGGTTGATCGGAGCAGTCTTGAAAACTGCAAGGGCCGCCAAGCCC |
Downstream region at tRNA end position |
gttttgaata |
Secondary structure (Cloverleaf model) | >WENV170649031 Ser TGA c GCCA gttttgaata G - C G - C A - T G - C G + T A - T G - C T A T C T C C C A T G A G | | | | | G G G G C C G A G G G C G + | | | T T T T C G G T G A A AAGGGCCGCCAAGCCCTC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |