Sequence ID | >WENV170649057 |
Genome ID | JRHI01005692 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 137 |
End posion on genome | 44 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgctctcctC |
tRNA gene sequence |
GGGGAGGTGGCTGAGAGGCTGAAAGCGCCCGCCTGCTAAGCGGGTGAGGGATGTTAAGTC |
Downstream region at tRNA end position |
ggcctgttta |
Secondary structure (Cloverleaf model) | >WENV170649057 Ser GCT C GCCC ggcctgttta G - C G - C G - C G + T A - T G - C G - C T A T C C C C C A A G A G | | | | | G G G T C G G G G G G C G | | | T T C A A G C T G A G TGAGGGATGTTAAGTCCCTCC C - G C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |