Sequence ID | >WENV170649114 |
Genome ID | JRHI01006471 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 3219 |
End posion on genome | 3129 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tccgcctcat |
tRNA gene sequence |
GGAGAGGTACCGAAGTGGTCGTAACGGGCGCGCCTCGAAAGCGTGTTGTCGGGTAACCGG |
Downstream region at tRNA end position |
cctccctcgc |
Secondary structure (Cloverleaf model) | >WENV170649114 Ser CGA t GCCA cctccctcgc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G T G A A | | | | | G G A G C C G T G G G C T | | | T T C A C G G G T A G TTGTCGGGTAACCGGCAC C - G G + T C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |