Sequence ID | >WENV170649115 |
Genome ID | JRHI01006495 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 171 |
End posion on genome | 84 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tggttttgag |
tRNA gene sequence |
GCCAGCGTGGTGGAACTGGTATACACGAACGACTCAAAATCGTTTGCGCTAACCGCGCAT |
Downstream region at tRNA end position |
gatttattca |
Secondary structure (Cloverleaf model) | >WENV170649115 Leu CAA g ACCA gatttattca G - C C - G C - G A - T G - C C - G G - C T C T C A G C C A C A A G | | | | | G T G G T G G T C G G C G | | | T T G A C A C T A T G TGCGCTAACCGCGCAT A - T A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |