Sequence ID | >WENV170649117 |
Genome ID | JRHI01006606 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 3017 |
End posion on genome | 2932 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgagtaccga |
tRNA gene sequence |
GGAGGGGTGCGAGAGCGGCCGAATCGGCACGATTGGAAATCGTGTGTGGGGCAACCCACC |
Downstream region at tRNA end position |
aaaatgctgg |
Secondary structure (Cloverleaf model) | >WENV170649117 Ser GGA a GCtc aaaatgctgg G - C G - C A - T G - C G + T G - C G - C T A T C A C C C A C G A G | | | | | A G G A G C G T G G G C G | | | T T C A T C G C G A G TGTGGGGCAACCCACC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |