Sequence ID | >WENV170649125 |
Genome ID | JRHI01006740 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 771 |
End posion on genome | 862 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gccgacgccC |
tRNA gene sequence |
GGAGGGATGGGTGAGTGGCTGAAACCAACCGTTTGCTAAATGGTCGTGGGTCTAAAAAAT |
Downstream region at tRNA end position |
tttgtggatc |
Secondary structure (Cloverleaf model) | >WENV170649125 Ser GCT C GAag tttgtggatc G - C G - C A - T G - C G - C G - C A - T T A T C T C T C A T G A G | | | | | G G G T G G G A G A G C G | | | T T C A A C C T G A A CGTGGGTCTAAAAAATCCACC A - T C - G C - G G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |