Sequence ID | >WENV170649128 |
Genome ID | JRHI01006809 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2820 |
End posion on genome | 2735 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcgtacactT |
tRNA gene sequence |
GCCCTGGTGGCGGAATTGGTAGACGCGCTGGTTTCAGGTATCAGTGACCGCAAGGTCGTG |
Downstream region at tRNA end position |
tcttgcgtat |
Secondary structure (Cloverleaf model) | >WENV170649128 Leu CAG T ATgg tcttgcgtat G - C C - G C - G C - G T T G - C G - C T G T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGACCGCAAGGTCGT C - G T - A G - C G + T T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |