Sequence ID | >WENV170649143 |
Genome ID | JRHI01007229 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2104 |
End posion on genome | 2190 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acagctagct |
tRNA gene sequence |
GGCGAGGTAGCGAAGCGGTCAAACGCAGCAGACTGTAAATCTGTCGCCCTAGCGGCTTCG |
Downstream region at tRNA end position |
cttatgaaga |
Secondary structure (Cloverleaf model) | >WENV170649143 Tyr GTA t ACCA cttatgaaga G - C G - C C - G G - C A - T G - C G - C T G T C T T C C A C G A A | | | | | G G A G C G G A A G G C G | | | T T T A C G C C A A A CGCCCTAGCGGCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |