Sequence ID | >WENV170649150 |
Genome ID | JRHI01007412 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1094 |
End posion on genome | 1178 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aattcggccc |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGCAGACGCGCAGGATTTAGGTTCCTGTGACGCAAGTCGTGGG |
Downstream region at tRNA end position |
cgcgcgtccg |
Secondary structure (Cloverleaf model) | >WENV170649150 Leu TAG c ACCA cgcgcgtccg G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A C A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C C A G G TGACGCAAGTCGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |