Sequence ID | >WENV170649177 |
Genome ID | JRHI01008890 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 165 |
End posion on genome | 251 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggcgctgcct |
tRNA gene sequence |
GCCGAGGTGGTGGAATAGGTAGACACGCCAGCTTGAGGGGCTGGTGGGCGCAAGCTCGTC |
Downstream region at tRNA end position |
tcgccagaaa |
Secondary structure (Cloverleaf model) | >WENV170649177 Leu GAG t ACCA tcgccagaaa G - C C - G C - G G - C A - T G - C G - C T G T G C C C C A T A A G | | | | | G A G G T G C G G G G C G | | | T T G A C A C T A G G TGGGCGCAAGCTCGT C - G C - G A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |