Sequence ID | >WENV170649195 |
Genome ID | JRHI01009606 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2373 |
End posion on genome | 2456 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acgcggaccc |
tRNA gene sequence |
GGGTCGGTGCCCGAGTGGCCAAAGGGAACGGTCTGTAAAACCGTCGCGCAAGCTTCGCTG |
Downstream region at tRNA end position |
ggaccccagg |
Secondary structure (Cloverleaf model) | >WENV170649195 Tyr GTA c ACCG ggaccccagg G - C G - C G - C T + G C - G G - C G - C C A T C G A C C A T G A G | | | | | G G G C C C G C T G G C G | | | T T C A G G G C A A A CGCGCAAGCTTC A - T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |