Sequence ID | >WENV170649231 |
Genome ID | JRHI01012058 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1373 |
End posion on genome | 1459 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aacgcttcgt |
tRNA gene sequence |
GCCGAAGTGGCGGAACAGGCAGACGCGTCGGTCTCAAACACCGATGGCCGCAAGGTCGTC |
Downstream region at tRNA end position |
ctccctcgct |
Secondary structure (Cloverleaf model) | >WENV170649231 Leu CAA t ACCA ctccctcgct G - C C - G C - G G - C A - T A - T G - C T G T G G C C C A C A A G | | | | | A A G G C G C C G G G C G | | | T T G A C G C C A G G TGGCCGCAAGGTCGT T - A C - G G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |