Sequence ID | >WENV170649244 |
Genome ID | JRHI01012504 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1268 |
End posion on genome | 1352 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtttgtcagt |
tRNA gene sequence |
GCGAAAGTGGCGGAATTGGCAGACGCACCAGACTTAGGATCTGGCGGGTAAAACCGTGGG |
Downstream region at tRNA end position |
atgatttatt |
Secondary structure (Cloverleaf model) | >WENV170649244 Leu TAG t ACCA atgatttatt G - C C - G G - C A - T A - T A - T G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C C A G A CGGGTAAAACCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |