Sequence ID | >WENV170649258 |
Genome ID | JRHI01014421 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1457 |
End posion on genome | 1368 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtctgtttgc |
tRNA gene sequence |
GGAAGGATGGCCGAGCGGTTTAAGGCAGCGGTCTTGAAAACCGCCGTGGACGCAAGCCCA |
Downstream region at tRNA end position |
tatttaaagc |
Secondary structure (Cloverleaf model) | >WENV170649258 Ser TGA c GCCA tatttaaagc G - C G - C A - T A - T G - C G - C A - T T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGACGCAAGCCCACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |