Sequence ID | >WENV170649260 |
Genome ID | JRHI01014483 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1195 |
End posion on genome | 1276 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggttgcattc |
tRNA gene sequence |
GGGTGGATACCCAAGCGGCCAAAGGGGCCAGACTGTAAATCTGGTGGCAATGCCTTCGCA |
Downstream region at tRNA end position |
cgcgtacgat |
Secondary structure (Cloverleaf model) | >WENV170649260 Tyr GTA c Atgt cgcgtacgat G - C G - C G - C T - A G - C G - C A - T T A T C G T C C A C G A A | | | | | G G A C C C G C A G G C G | | | T T C A G G G C A A G TGGCAATGCCTTC C - G C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |