Sequence ID | >WENV170649266 |
Genome ID | JRHI01014949 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1107 |
End posion on genome | 1191 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctrgcscntg |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGTAGACGCGCSGGATTTAGGTTCCCGTGACGAAAGTCGTGGG |
Downstream region at tRNA end position |
tccgctctgg |
Secondary structure (Cloverleaf model) | >WENV170649266 Leu TAG g ACCA tccgctctgg G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A C A A G | + | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGACGAAAGTCGT C - G S C G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |