Sequence ID | >WENV170649272 |
Genome ID | JRHI01015397 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 996 |
End posion on genome | 908 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aatccctttg |
tRNA gene sequence |
GCCGGGGTGGCGGAACTGGCAGACGCACAGGACTTAAAATCCTGGGTCCCGCAAGGGGCG |
Downstream region at tRNA end position |
cgttcgacca |
Secondary structure (Cloverleaf model) | >WENV170649272 Leu TAA g ACTA cgttcgacca G - C C - G C - G G - C G - C G - C G - C G T T C G C C C A C A A G | + | | | G T G G C G G T G G G C G | | | T T G A C G C C A G A GGTCCCGCAAGGGGCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |