| Sequence ID | >WENV170649544 |
| Genome ID | JRYC01018665 |
| Phylum/Class | [JRYC] activated sludge metagenome; activated biomass of a common effluent treatment plant treating industrial wastewater |
| Species | |
| Start position on genome | 560 |
| End posion on genome | 486 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
cagaggctgt |
| tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTAGAGCGCCTCGTTTACACCGAGGATGTCGGGGGTTCGATCC |
| Downstream region at tRNA end position |
tcgacatgga |
| Secondary structure (Cloverleaf model) | >WENV170649544 Val TAC
t ACCA tcgacatgga
G - C
G - C
G - C
C - G
G - C
G - C
T - A C T
T C T C C C A
G A A | + | | | G
C C T C G G G G G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
T - A
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |