Sequence ID | >WENV170652195 |
Genome ID | JRYH01000040 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 16673 |
End posion on genome | 16597 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtccgatgga |
tRNA gene sequence |
GGCTCCTTAGCTCAGTTGGTTAGAGCGGTGGAATCATAATCCATGTGTCCCCAGTTCGAG |
Downstream region at tRNA end position |
ttttccccct |
Secondary structure (Cloverleaf model) | >WENV170652195 Met CAT a ACCA ttttccccct G - C G - C C - G T - A C - G C - G T - A T G T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A G GTGTC G + T T - A G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |