Sequence ID | >WENV170652196 |
Genome ID | JRYH01000041 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 53807 |
End posion on genome | 53731 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ctgcggacaa |
tRNA gene sequence |
GGGCGTATAGCTCAGTTGGTTAGAGCGCTGTGTTGACATCGCAGAGGTCACAAGTTCGAA |
Downstream region at tRNA end position |
ttcccaaacc |
Secondary structure (Cloverleaf model) | >WENV170652196 Val GAC a ACCA ttcccaaacc G - C G - C G - C C - G G - C T - A A - T T A T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C T + G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |