Sequence ID | >WENV170652197 |
Genome ID | JRYH01000044 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8539 |
End posion on genome | 8463 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gatttggaac |
tRNA gene sequence |
GGGTGATTAGCTCAGCTGGTTAGAGCATCTCGTTTACACCGAGAGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tccagatcaa |
Secondary structure (Cloverleaf model) | >WENV170652197 Val TAC c ACCA tccagatcaa G - C G - C G - C T - A G - C A - T T - A T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |