Sequence ID | >WENV170652198 |
Genome ID | JRYH01000044 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 8194 |
End posion on genome | 8118 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gccgtcttgc |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTTAGAGCGTCGGCCTGTCACGCCGAAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ttttcccgaa |
Secondary structure (Cloverleaf model) | >WENV170652198 Asp GTC c GCCA ttttcccgaa G - C G + T G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |