Sequence ID | >WENV170652200 |
Genome ID | JRYH01000045 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4906 |
End posion on genome | 4822 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gattttgaac |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGTAGACGCGCTGGTTTTAGGTACCAGTTTCTTACGAAGTGGG |
Downstream region at tRNA end position |
tgattgaaca |
Secondary structure (Cloverleaf model) | >WENV170652200 Leu TAG c ACCA tgattgaaca G - C C - G G - C G - C G - C T - A G - C T T T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TTTCTTACGAAGT C - G T - A G - C G - C T - A T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |