Sequence ID | >WENV170652201 |
Genome ID | JRYH01000047 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 12958 |
End posion on genome | 12882 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccatgccgt |
tRNA gene sequence |
CGGGGCGTAGCACAGCCTGGTAGTGCGCTCGCTTTGGGAGCGAGAGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
ttcttccccc |
Secondary structure (Cloverleaf model) | >WENV170652201 Pro TGG t ACCA ttcttccccc C - G G - C G - C G - C G - C C - G G - C T A T C G T T C A C G A A | | | | | G C C A C G G C A A G C T | | | | T T G G T G C G T A G AGGTC C - G T - A C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |