Sequence ID | >WENV170652202 |
Genome ID | JRYH01000047 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 11831 |
End posion on genome | 11755 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cgacatgaac |
tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCAATTGACTTCTAATCAATAGGTCGCACGTTCGAG |
Downstream region at tRNA end position |
gacatcgatg |
Secondary structure (Cloverleaf model) | >WENV170652202 Arg TCT c GCCA gacatcgatg G - C G + T C - G C - G C - G C - G G - C T G T C G T G C A C G A A | | | | | G T C T C G G C A C G C G | | | | T T G G A G C A T A A AGGTC A - T T - A T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |