Sequence ID | >WENV170652203 |
Genome ID | JRYH01000072 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 60136 |
End posion on genome | 60060 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcgacatcag |
tRNA gene sequence |
GCACCGGTAGCTCAGCTGGATAGAGCACCAGACTACGAATCTGGGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tcttcaaagg |
Secondary structure (Cloverleaf model) | >WENV170652203 Arg ACG g GCCA tcttcaaagg G - C C - G A - T C - G C - G G - C G - C T A T C C T T C A C G A A | | + | | G T C T C G G G G A G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |