Sequence ID | >WENV170652205 |
Genome ID | JRYH01000080 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 20471 |
End posion on genome | 20561 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcttggcga |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGCTGAAGGCGGCGCTTTGCTAAAGCGTTATACGGCAAAACCGT |
Downstream region at tRNA end position |
cgacttaagc |
Secondary structure (Cloverleaf model) | >WENV170652205 Ser GCT a GCCA cgacttaagc G - C G - C A - T G - C A - T C - G G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGGCAAAACCGTATC G + T C - G G - C C - G T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |