Sequence ID | >WENV170652206 |
Genome ID | JRYH01000080 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 153525 |
End posion on genome | 153599 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agggactttc |
tRNA gene sequence |
GGGCGGGTAGCTCAGTGGTAGAGCATCTGACTTTTAATCAGATGGCCGTGGGTTCGATCC |
Downstream region at tRNA end position |
aggatttcaa |
Secondary structure (Cloverleaf model) | >WENV170652206 Lys TTT c ACCA aggatttcaa G - C G + T G - C C - G G - C G - C G - C C T T C A C C C A G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGCC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |