Sequence ID | >WENV170652208 |
Genome ID | JRYH01000096 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 26521 |
End posion on genome | 26598 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ggggccaagt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTTAGCGCACCAGTCTGGGGGACTGGGGGTCGGGAGTTCAA |
Downstream region at tRNA end position |
tctcaactgt |
Secondary structure (Cloverleaf model) | >WENV170652208 Pro GGG t ACCA tctcaactgt C - G G - C G - C A - T G - C C - G G - C T A T C C C T C A C C G A A | | | | | A T C G C G G G G A G C G | | | | T T G G C G C T T A A GGGTC C - G C - G A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |