Sequence ID | >WENV170652209 |
Genome ID | JRYH01000096 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 67031 |
End posion on genome | 67117 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ccggatccct |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTAGACACACAGGACTTAAAATCCTGAGACGGCAACGTCGTG |
Downstream region at tRNA end position |
ggctccggac |
Secondary structure (Cloverleaf model) | >WENV170652209 Leu TAA t ACCA ggctccggac G - C C - G G - C G - C A - T C - G G - C C T T C T C C C A T A A G | | | | | G T G G T G G A G G G C G | | | T T G A C A C T A G A AGACGGCAACGTCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |