Sequence ID | >WENV170652212 |
Genome ID | JRYH01000098 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 83192 |
End posion on genome | 83276 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atgcatgtgc |
tRNA gene sequence |
GGAGGGATGCCTGAGTGGTTAAAAGGGACGGACTGTAAATCCGTTGGCACTGCCTACGTT |
Downstream region at tRNA end position |
cctgcatgac |
Secondary structure (Cloverleaf model) | >WENV170652212 Tyr GTA c ACCA cctgcatgac G - C G - C A - T G - C G - C G - C A - T T A T C A A C C A T G A G | | | | | A G G T C C G T T G G C G | | | T T T A A G G T A A G TGGCACTGCCTAC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |