Sequence ID | >WENV170652216 |
Genome ID | JRYH01000114 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7200 |
End posion on genome | 7289 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cccccgaccc |
tRNA gene sequence |
GGAGAGGTGCCAGAGCGGTCGAATGGGCCGGACTCGAAATCCGGTGTACGGCTTGCCGTA |
Downstream region at tRNA end position |
cccacaaaaa |
Secondary structure (Cloverleaf model) | >WENV170652216 Ser CGA c GCCA cccacaaaaa G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C G A G | | | | | G G G A C C G T G G G C G | | | T T T A T G G C G A G TGTACGGCTTGCCGTACC C - G C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |