Sequence ID | >WENV170652217 |
Genome ID | JRYH01000114 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 51254 |
End posion on genome | 51327 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cccgcccggt |
tRNA gene sequence |
GGCTAGGTGGCAGAGTGGTGATGCAGCGGCCTGCAAAGCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
tcccttgtct |
Secondary structure (Cloverleaf model) | >WENV170652217 Cys GCA t TCCA tcccttgtct G - C G - C C - G T - A A - T G - C G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T G A GTAC G + T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |