Sequence ID | >WENV170652219 |
Genome ID | JRYH01000116 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 45620 |
End posion on genome | 45696 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cactcccagt |
tRNA gene sequence |
TCCCGGGTAGCTCAGTTGGTTAGAGCGGGTGACTGTTAATCACTAGGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
tatcacccaa |
Secondary structure (Cloverleaf model) | >WENV170652219 Asn GTT t GCCA tatcacccaa T - A C - G C - G C - G G - C G - C G - C T G T C T C C C A T G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A G AGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |