Sequence ID | >WENV170652222 |
Genome ID | JRYH01000123 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 35333 |
End posion on genome | 35417 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gctgggacaa |
tRNA gene sequence |
GCGGACGTGGCGAAATTGGTAGACGCATCGGCTTTAGGTGCCGACGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
ggggtcggca |
Secondary structure (Cloverleaf model) | >WENV170652222 Leu TAG a ACCA ggggtcggca G - C C - G G - C G - C A - T C - G G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT T - A C - G G - C G - C C - G T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |