Sequence ID | >WENV170652225 |
Genome ID | JRYH01000147 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 40312 |
End posion on genome | 40401 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cggacagcac |
tRNA gene sequence |
GGAGGGTTGGCAGAGCGGTTGATTGCACTGGTCTTGAAAACCAGCAAGGGTGCAAGCCCT |
Downstream region at tRNA end position |
tttaatgcgt |
Secondary structure (Cloverleaf model) | >WENV170652225 Ser TGA c GCCA tttaatgcgt G - C G - C A - T G - C G - C G - C T - A T A T G C C C C A C G A G | | | | | G G G A C G C G G G G C G + | | | T T T T T G C T G A A CAAGGGTGCAAGCCCTTC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |